Journal of Endocrinology and Metabolism, ISSN 1923-2861 print, 1923-287X online, Open Access
Article copyright, the authors; Journal compilation copyright, J Endocrinol Metab and Elmer Press Inc
Journal website https://jem.elmerpub.com

Original Article

Volume 16, Number 1, February 2026, pages 29-37


Investigation of GHRL, RETN, ADIPOQ, NPY and MC4R Gene Polymorphisms in Obese and Non-Obese Patients With Diabetes

Figures

Figure 1.
Figure 1. Biochemical parameters measured in the study groups. ALT: alanine aminotransferase; TG: triglyceride; HDL-C: high-density lipoprotein cholesterol.
Figure 2.
Figure 2. NPY allele distribution in study groups.

Tables

Table 1. Primer Sequences for PCR Amplification of RETN rs1862513, GHRL rs4684677, MC4R rs17782313, NPY rs16147 and ADIPOQ rs2241766 Genes
 
SNPForward primer (5'–3')Forward/reverse primer (5'–3')Reverse primer (5'–3')
PCR: polymerase chain reaction; SNP: single-nucleotide polymorphism.
rs1862513GGGCATTTGGGTATGAATGTGTTCCAACAGGGCCTCCGTTCCAACAGGGCCTCCA
rs4684677TGGCTGTGCTGCTGGTACTTGGCTGTGCTGCTGGTACCAGATGGTGAGTGGGAAGGTG
rs17782313GCTTTTCTTGTCATTTCCATCAGCTTTTCTTGTCATTTCCATCTTAACAAACAGCCCCCAAGTC
rs16147TCAGCAAACTGGGGGAATAGCCTGCCAACAGGACTACCAACCTGCCAACAGGACTACCAT
rs2241766GCTATTAGCTCTGCCCGGTGCTATTAGCTCTGCCCGGGTGAGGGTGAAGATGGGAAAG

 

Table 2. Demographic and Clinical Data of Obese and Non-Obese Diabetic Groups
 
Non-obese diabeticObese diabeticP value
The values expressed as X ± SE in the table were analyzed using independent samples t-tests (X: mean; SE: standard error). P represents the significance of value between the groups. *P < 0.05. ALT: alanine aminotransferase; AST: aspartate aminotransferase; TC: total cholesterol; TG: triglyceride; HDL-C: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; HbA1c: hemoglobin A1c; BMI: body mass index.
Age50.86 ± 1.5155.89 ± 1.020.006*
Urea31.37 ± 0.9835.79 ± 1.820.034*
Creatinine0.78 ± 0.020.85 ± 0.040.08
ALT19.60 ± 1.0123.27 ± 1.250.024*
AST18.10 ± 0.6620.03 ± 0.840.075
TC200.50 ± 5.63211.35 ± 8.260.281
TG139.64 ± 8.53189.82 ± 13.420.002*
HDL-c50.89 ± 1.7646.29 ± 1.020.025*
LDL-c122.01 ± 4.58121.87 ± 3.330.968
Glucose163.98 ± 6.81181.78 ± 6.710.064
HbA1c8.14 ± 0.228.33 ± 0.190.514
BMI24.80 ± 0.3136.00 ± 0.45< 0.0001*

 

Table 3. Genotype and Allele Frequencies of RETN rs1862513, GHRL rs4684677, MC4R rs17782313, NPY rs16147 and ADIPOQ rs2241766 Polymorphisms in the Study Groups
 
Genotypes/allelesObese diabetic, n (%)Non-obese diabetic, n (%)P value
P represents the significance of value between the groups. *P < 0.05.
RETN rs1862513
  CC46 (46.5%)43 (43.4%)0.005*
  CG46 (46.5%)33 (33.3%)
  GG7 (7.1%)23 (23.2%)
  C allele138 (69.7%)119 (60.1%)0.002*
  G allele60 (30.3%)79 (39.9%)0.67
GHRL rs4684677
  TT0 (0%)2 (2%)0.36
  TA5 (5.1%)5 (5.1%)
  AA94 (94.9%)92 (92.9%)
  T allele5 (2.5%)9 (4.5%)0.551
  A allele193 (97.5%)189 (95.5%)0.155
MC4R rs17782313
  TT7 (7.1%)20 (20.2%)0.008*
  TC83 (83.8%)65 (65.7%)
  CC9 (9.1%)14 (14.1%)
  T allele97 (49%)105 (53 %)0.267
  C allele101 (51%)93 (47%)0.007*
NPY rs16147
  TT26 (26.3%)11 (11.1%)< 0.0001*
  TC71 (71.7%)67 (67.7%)
  CC2 (2%)21 (21.2%)
  T allele123 (62.1%)89 (45%)< 0.0001*
  C allele75 (37.9%)109 (55%)0.006*
ADIPOQ rs2241766
  TT76 (76.8%)78 (78.8%)0.1
  TG10 (10.1%)3 (3%)
  GG13 (13.1)18 (18.2%)
  T allele162 (81.8%)159 (80.3%)0.328
  G allele36 (18.2%)39 (19.7%)0.732